Regulation of pluripotency in male germline stem cells by Dmrt1Supplementaldata.docx

1、Regulation of pluripotency in male germline stem cells by Dmrt1 SupplementaldataSupplemental information for Regulation of pluripotency in male germline stem cells by Dmrt1Seiji Takashima, Michiko Hirose, Narumi Ogonuki, Miki Ebisuya, Kimiko Inoue, Mito Kanatsu-Shinohara, Takashi Tanaka, Eisuke Nish

2、ida, Atsuo Ogura, Takashi ShinoharaSupplemental information for this paper contains materials shown below.Supplemental Figure S1-10Supplemental Table S1-5Supplemental experimental proceduresSupplemental referencesSupplemental Figure S1. Confirmation of KD by realtime PCR. (A) Realtime PCR analysis o

3、f Dnmt1 in p53 KO GS cells 7 days after transfection (n = 3). (B, C) Realtime PCR analysis of p53 (B) and Dnmt1 (C) in WT KO GS cells 7 days after transfection (n = 3). pSicoR was used as a control. Supplemental Figure S2. Expression of GCT candidate gene OE/KD in GS cells. (A) Confirmation of KD by

4、 realtime PCR. p53 KO GS cells were infected with the indicated lentivirus and gene expression was analyzed by realtime PCR 7 days after transfection (n = 3). WT GS cells were used for Bax KD. pLKO.1 EGFP was used as a control. (B) Confirmation of OE by RT-PCR. p53 KO GS cells were infected with the

5、 indicated lentivirus and gene expression was analyzed by RT-PCR 7 days after transfection using transgene-specific (cDNA-IRES2) primer pair. A lentivirus vector containing the appropriate cDNA-IRES2 sequence was used as a positive control. Cyclin E1 was co-transfected with cyclin D2 to promote its

6、tumorigenicity (Lee et al. 2009). CSII-EF1-IRES2-hKO1 was used as a control for Hras, whereas CSII-EF1-IRES2-Venus was used as a control for the rest of the genes. (C) Confirmation of OE by realtime PCR. p53 KO GS cells were infected with the indicated lentivirus and gene expression was analyzed by

7、realtime PCR 7 days after transfection (n = 3). CSII-EF1-IRES2-Venus was used as a control. moi, multiplicity of infection. Supplemental Figure S3. Derivation of Dmrt1-mGS cells. (A) Development of epiblast-like colonies during reprogramming that occurred in GS cells derived from a transgenic line t

8、hat expresses EGFP under the control of a Nanog promoter. (B) Derivation of Dmrt1-mGS cells from adult WT DBA/2 GS cells. Bar = 200 m (A), 100 m (B). Supplemental Figure S4. Characterization of Dnmt1- and Dmrt1-mGS. (A) RT-PCR analysis. (B) Flow cytometric analysis. (C) Nanog immunostaining. (D) Bis

9、ulfite sequencing analysis of the DMRs of H19 and Igf2r. Open circles, unmethylated CpG; closed circles, methylated CpG. (E) Design of the p53 KD and Dnmt1 KD vectors. EGFP and the shRNA oligo are flanked by loxP sites (yellow triangles), which can be removed by cre-mediated recombination. 5LTR, 5 l

10、ong terminal repeat; Psi, packaging signal; cPPT, central polypurine tract; CMV, cytomegalovirus promoter; WPRE, woodchuck hepatitis virus posttranscriptional regulatory element; 3LTRU3, 3LTR with deletion of the enhancer and promoter sequences in the U3 region. (F) Dnmt1-mGS cells induced from ROSA

11、 GS cells. Cre-mediated recombination was confirmed by extinction of EGFP fluorescence. (G) Section of teratomas under the skin, showing tissues of three germ layers. (H) RT-PCR analysis of spermatogonia marker expression in Dnmt1- and Dmrt1-mGS cells. (I) COBRA of tail DNA from offspring of Dmrt-mG

12、S chimera . PCR products were digested with the indicated enzymes. Percent methylation is shown below the gels. U, non-cleaved; C, cleaved. Bar = 100 m (C, G), 50 m (F).Supplemental Figure S5. Realtime PCR analysis of Dmrt1 target genes in WT-GS cells after Dmrt1 KD (n = 3). pLKO.1 EGFP was used as

13、a control. All experiments were carried out with concurrent p53 KD. Supplemental Figure S6. Apoptosis of GS cells by transfection. (A, B) Suppression of apoptosis by p53 deficiency after Sox2 (A) or Oct4 (B) OE. For each cell type, at least 82 cells were counted 7 days after transfection (n = 5). CS

14、II-EF1-IRES2-hKO1 and CSII-EF1-IRES2-Venus were used as controls for Sox2 and Oct4 OE, respectively. (C) Suppression of apoptosis by p53 deficiency after Oct KD. For each cell type, at least 100 cells were counted 7 days after transfection (n = 5). pLKO.1 EGFP was used as a control. Supplemental Fig

15、ure S7. Western blot analysis of Oct4 and Sox2 expression in p53 KO GS cells 4 days after Sox2 OE. CSII-EF1-IRES2-hKO1 was used as a control. Supplemental Figure S8. Realtime PCR analysis of Oct4 target gene expression in p53 KO GS cells after Oct1 OE (A), Oct1 KD (B), Oct4 OE (C) and Oct 4 KD (D) 1

16、4 days after transfection. CSII-EF1-IRES2-Venus and pLKO.1 EGFP was used as controls for OE and KD experiments, respectively. Expression of Dax1, Fgf4, Lefty1, Pml, and Nanog was not detectable in GS cells. Supplemental Figure S9. Characterization of Sox2- and Oct4-mGS. (A) RT-PCR analysis. (B) Flow

17、 cytometric analysis. (C) Nanog immunostaining. (D) In vitro differentiation. (E) Bisulfite sequencing analysis of the DMRs of H19 and Igf2r. Open circles, unmethylated CpG; closed circles, methylated CpG. (F) Design of the Sox2/Oct4 removable expression vector. The cDNA insert is flanked by loxP si

18、tes (yellow triangles), which can be removed by cre-mediated recombination. Deletion of the cDNA insert initiates DsRed expression. 5LTR, 5 long terminal repeat; Psi, packaging signal; cPPT, central polypurine tract; CMV, cytomegalovirus promoter; WPRE, woodchuck hepatitis virus posttranscriptional

19、regulatory element; 3LTRU3, 3LTR with deletion of the enhancer and promoter sequences in the U3 region. (G) Sox2-mGS and Oct4-mGS induced from green GS cells. Cells were then subjected to cre-mediated deletion of the Sox2/Oct4 transgene. Cre-mediated deletion was confirmed by expression of DsRed flu

20、orescence. Bar = 100 m (C, D), 50 m (G).Supplemental Figure S10. Scatter plot comparison of the global gene expression profiles. Black lines indicate boundaries of 2-fold difference in gene expression. Supplemental Table S1. Summary of mGS cell inductionGS cellGene transductionMultiplicity of infect

21、ionNo. of wellsculturedNo. of wells with mGS cellsDay colonies examinedp53 KODnmt1 KD23228Dmrt1 KD233Dnd1 KD4.731Pten KD0.930Cdk4 OE3.430Cyclin D2 OECyclin E1 OE9.50.9730Akt OE0.330-Catenin OE1.730HRas OE0.830Bcl6b OE4.930Fgfr3 OE4.830Lats2 KD1.730Sprouty4 OE3.230KitL OE4.730Tert OE0.730WTpSicoR2060

22、pLKO.1 EGFP240p53 KD10220Dnmt1 KD240Dmrt1 KD270Dnmt1 KDp53 KD210153Dnmt1 KDp53 KD1010129Dmrt1 KDp53 KD2103021Dnd1 KDp53 KD101070Sox2 OEp53 KD101022721UTF OEp53 KD1010120p19 KDp53 KD1010200p18 KDp53 KD1010120Oct4 OEp53 KD10103112Oct1 KDp53 KD1010123Oct4 OEOct1 KDp53 KD101010158Oct4 OEOct1 OEp53 KD101

23、01083Oct6 KDp53 KD1010120Cells (5 105) were cultured in 6-well plates.Supplemental Table S2. Contribution of mGS cells to embryonic developmentDonor cellBlastocystNo. of embryos transferredNo. of embryos implanted (%)No. of pups born (%)ChimeraMaleFemaleDnmt1-mGSB6ICR1533038 (24.8)NA1 (0.0)10 (33.3)

24、NA1/4 (25.0)NA0 (0)Dmrt1-mGSB621438 (17.8)2 (0.9)1/1 (100.0)0 (0)Sox2-mGSB64214 (33.3)9 (21.4)3/5 (60.0)1/3 (33.3)ICR7220 (27.8)9 (12.5)1/3 (33.3)2/5 (40.0)Oct4-mGSB65225 (48.1)3 (5.8)NANAICR54NA21 (38.9)8/12 (66.7)4 /8 (50.0)NA, not applicable. Cannibalized pups are not included in chimera analysis

25、. Supplemental Table S3. pLKO. 1 lentivirus vectors used in KD experimentsGeneTRC ID NumberBaxTRCN0000009668, TRCN0000009669, TRCN0000009670, TRCN0000009672Dmrt1TRCN0000084388, TRCN0000084389, TRCN0000084390, TRCN0000084391, TRCN0000084392Dnd1TRCN0000247049, TRCN0000247050, TRCN0000247051, TRCN00002

26、57069EGFPTRC Lentiviral EGFP shRNA Positive ControlLats2TRCN0000022705, TRCN0000022706, TRCN0000022707Oct1TRCN0000175063, TRCN0000175090, TRCN0000240638Oct4TRCN0000009611, TRCN0000009612, TRCN0000009613, TRCN0000009614, TRCN0000009615Oct6TRCN0000075418, TRCN0000075419, TRCN0000075420, TRCN0000075421

27、, TRCN0000075422p18TRCN0000085033, TRCN0000085034, TRCN0000085037PtenTRCN0000028990, TRCN0000028992, TRCN0000028993Sox2TRCN0000085748, TRCN0000085749, TRCN0000085750, TRCN0000085751, TRCN0000085752Supplemental Table S4. Primers for PCR and bisulfite sequencing GeneForward primerReverse primerAktTTCC

28、TCTCAAGAACGATGGCTCTGTCTTCATCAGCTGGCAkt-IRES2AGATGATCACCATCACGCCCGACATTCAACAGACCTTGC-cateninAGCAAGCTCATCATTCTGGCTGAACAAGTCGCTGACTTGG-catenin-IRES2TTCACTCTGGTGGATACGGCCTTATTCCAAGCGGCTTCGBaf155GATGTGTGTGCTGTGATGAGGGAGGTGATCGAAGATGCAGGBaxAGGATGATTGCTGACGTGGTGATGGTTCTGATCAGCTCGBcl6bCCCGGGCTCAAGAGACTTCTTC

29、CTGGGCGGTGGATTAGCBcl6b-IRES2GCAGCAGTGAAGAAGGAACCCTTCGGCCAGTAACGTTAGGc-mycTGCAGGACCTCACCGCCTTCTTGCTCTTCTTCAGAGTCGCdk4TGCAGTCTACATACGCAACACCTCGTCTTCTGGAGGCAATCCCdk4-IRES2TAAGCCAATCTCTGCCTTCCCGACATTCAACAGACCTTGCCriptoGGTCTATCCTCCATGGCACCCATCACGTGACCATCACAGCCyclin D2TTCATTGAGCACATCCTTCGTTCATCATCCTGCTGAA

30、GCCCyclin D2-IRES2ATGATTGCAACTGGAAGCGCTTCGGCCAGTAACGTTAGGCyclin E1-IRES2CTCAGGTTATCAGTGGTGCGCTTCGGCCAGTAACGTTAGGDax1ATCTGGAAGCAGGGCAAGTATCCTGTACCGCAGCTATGTGDmrt1ATGAAGACCTCAGAGAGCCGCAAGCCAGAATCTTGACTGCDnd1AGTTCAGTACGCACCGAGCGTTGACACAGCAGTTGCAGGDnmt1ACTGGAAGAGGTAACAGCGGGCCTCAATGATAGCTCTCTGGErasTCAGATCCGCCTACTGCCTTACCAACACCACTTGCACCEsrrbACCATTCAAGGCAACATCGCACACCTTCCTTCAGCATCCEtv5AACTTGGTGCTTCATGCTCCACTTAGCACCAAGAGCCTGCFbxo15AGAAGCGTTGCTCTTCCTCCAATGCAGCTGCGTACTTCCFgf4GAGGCGTGGTGAGCATCTT