RFLPWord格式文档下载.docx

1、 2003, American Society for Microbiology. All Rights Reserved. Intraspecies Polymorphism of Cryptosporidium parvum Revealed by PCR-Restriction Fragment Length Polymorphism （RFLP） and RFLP-Single-Strand Conformational Polymorphism Analyses Zhiliang Wu, Isao Nagano, Thidarut Boonmars, Takumi Nakada, a

2、nd Yuzo Takahashi* Department of Parasitology, Gifu University School of Medicine, Tsukasa 40, Gifu 500-8705, Japan Received 27 January 2003/ Accepted 26 May 2003 ABSTRACT TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferencesA glycoprotein （Cpgp40/15）-encoding gene of Cryptosporidi

3、um parvum was analyzed to reveal intraspecies polymorphism within C. parvum isolates. Forty-one isolates were collected from different geographical origins （Japan, Italy, and Nepal） and hosts （humans, calves, and a goat）. These isolates were characterized by means of DNA sequencing, PCR-restriction

4、fragment length polymorphism （PCR-RFLP）, and RFLP-single-strand conformational polymorphism （RFLP-SSCP） analyses of the gene for Cpgp40/15. The sequence analysis indicated that there was DNA polymorphism between genotype I and II, as well as within genotype I, isolates. The DNA and amino acid sequen

5、ce identities between genotypes I and II differed, depending on the isolates, ranging from 73.3 to 82.9% and 62.4 to 80.1%, respectively. Those among genotype I isolates differed, depending on the isolates, ranging from 69.0 to 85.4% and 54.8 to 79.2%, respectively. Because of the high resolution ge

6、nerated by PCR-RFLP and RFLP-SSCP, the isolates of genotype I could be subtyped as genotypes Ia1, Ia2, Ib, and Ie. The isolates of genotype II could be subtyped as genotypes IIa, IIb, and IIc. The isolates from calves, a goat, and one Japanese human were identified as genotype II. Within genotype II

7、, the isolates from Japan were identified as genotype IIa, those from calves in Italy were identified as genotype IIb, and the goat isolate was identified as genotype IIc. All of the genotype I isolates were from humans. The Japanese isolate （code no. HJ3） and all of the Nepalese isolates were ident

8、ified as genotypes Ia1 and Ia2, respectively. The Italian isolates were identified as genotype Ib, and the Japanese isolate （code no. HJ2） was identified as genotype Ie. Thus, the PCR-RFLP-SSCP analysis of this glycoprotein Cpgp40/15 gene generated a high resolution that has not been achieved by pre

9、vious methods of genotypic differentiation of C. parvum. INTRODUCTION Among known Cryptosporidium spp. （see the review by Xiao et al. 19）, Cryptosporidium parvum is supposedly the main species that infects humans （7）. Previous studies have shown that C. parvum is mainly composed of two genotypes, I

10、and II. The former has been found in human patients and is therefore referred to as the human type （5, 7）. Genotype II was first found in cattle and is therefore referred to as the cattle type. Since then, however, this type has been found in a wide range of mammals, including humans （4, 8）. Thus, b

11、oth genotypes are responsible for outbreaks of human cryptosporidiosis and sporadic infections in immunocompromised individuals （6）. Despite extensive earlier studies, it is still unclear whether the pathogenesis, virulence, infectivity, or drug sensitivity of Cryptosporidium is related to some spec

12、ific genotype or not. Also, genotypic information is needed to detect Cryptosporidium by means of PCR for tap water monitoring and/or to trace the infection route of the parasite. Gene fingerprinting is a promising method with which to fulfill such requirements. Recently, one gene encoding a glycopr

13、otein （named Cpgp40/15） of C. parvum was listed as a candidate target gene for genetic analysis of C. parvum. Sequence analysis of the Cpgp40/15 gene indicated the presence of polymorphic variants within genotype I isolates, which have been divided into five subcategories so far （2, 11）. This study

14、was undertaken to search for more advantages of the Cpgp40/15 gene for the identification and gene fingerprinting of C. parvum isolates adapting more sophisticated methods, namely, restriction fragment length polymorphism （RFLP） and single-strand conformational polymorphism （SSCP）. MATERIALS AND MET

15、HODS Parasite isolates.A total of 41 isolates of C. parvum were used. Six isolates were from calves in Gifu, Japan （code no. CGJ1 to CGJ6）; 11 were from calves in Kobe, Japan （code no. CKJ1 to CKJ11）; 1 was from a calf in Nagoya, Japan （code no. CNJ1）; 8 were from calves in Italy （code no. CI1 to CI

16、8）; 1 was from a goat in Italy （code no. GI1）; 3 were from humans in Japan （code no. HJ1 to HJ3）; 5 were from humans in Italy （code no. HI1 to HI5）; and 6 were from humans in Nepal （code no. HN1 to HN6）. All fecal samples were preserved in 2% K2Cr2O7, and oocysts were isolated by the sucrose flotati

17、on method. The samples were subjected to further purification with an immunomagnetic separation kit （Dynabeads anti-Cryptosporidium; Dynal AS, Oslo, Norway）. Template DNA for PCR was prepared as described previously （15）. In brief, oocysts were frozen and thawed five times and treated at 100C for 20

18、 min. The samples were then digested with proteinase K at a final concentration of 200 g/ml at 55C for 3 h and heated at 95C for 5 min to stop the digestion. Thus-treated samples were directly used for PCR under the conditions described in the following paragraph. Development of PCR primer and PCR c

19、onditions.A pair of primers （CCGTTATAGTCTCCGCTGTA and AAAGCAGAGGAACCGGCAT） were developed for amplification of the gene for Cpgy40/15 on the basis of the published sequence data （GenBank accession number AF022929） （11）. The PCR conditions used were as follows: 1 initial denaturation cycle of 94C for

20、 3 min; 35 cycles of 94C for 30 s, 54C for 30 s, and 72C for 1 min; and 1 final extension cycle of 72C for 10 min. DNA sequencing.The Cpgy40/15-encoding genes from 16 isolates （including 8 calf isolates from Japan and Italy, 1 goat isolate from Italy, and 7 human isolates from Japan, Italy, and Nepa

21、l） were sequenced. PCR products were purified with a GeneClean II Kit （Bio 101, Carlsbad, Calif.）. DNA fragments were ligated into a pT7Blue T-Vector （Novagen, Inc., Madison, Wis.）. The recombinant plasmids were introduced into competent cells of Escherichia coli JM109. The plasmid DNA was isolated

22、from E. coli with a FlexiPrep Kit （Amersham Pharmacia Biotech Inc., Piscataway, N.J.）. The DNA was sequenced with a Thermo Sequenase cycle sequencing kit （USB Corporation, Cleveland, Ohio） and an automatic sequencer （LIC-4200; Aloka Co., Ltd.）. The sequence data were analyzed with DNASIS software （H

23、itachi Software Engineering, Tokyo, Japan）. Homology searching of the nucleotide and protein sequence database was carried out with the BLAST program at the National Center for Biotechnology Information （Bethesda, Md.）. Pairwise sequence alignments and protein identity determinations were performed

24、with ClustalW1.81 and PHYLIP DNADIST software. RFLP and SSCP.PCR-RFLP analysis was performed as previously described （14, 16）. PCR products were purified by ethanol precipitation and then digested with the appropriate restriction endonucleases （AluI and RsaI） in accordance with the manufacturers ins

25、tructions. PCR-RFLP-SSCP is a highly sensitive method developed by Wu et al. （16）. In brief, the PCR-RFLP product was mixed at a 1:1 ratio with denaturing solution （95% vol/vol formamide, 0.02% wt/vol xylene cyanol, 0.02% wt/vol bromophenol blue, 20 mM EDTA pH 8.0） and heated at 95C for 5 min. The d

26、enatured samples were cooled in ice immediately. Seven-microliter samples were applied to the gel, and the DNA samples were run at 600 V, 50 mA, 30 W, and 10C for 110 min. After electrophoresis, the gel was stained with a PlusOne DNA silver staining kit （Amersham Pharmacia Biotech AB, Uppsala, Swede

27、n）. RESULTS Analysis of the Cpgp40/15 gene.Of the 41 isolates, 16 from different geographical origins and hosts were chosen for DNA sequencing. The lengths of the amplicons produced by the primer developed for Cpgy40/15 were variable among isolates, ranging from 883 to 961 bp, and the DNA sequences

28、of the amplicons were also diverse, as shown in Table 1 and Fig. 1. View this table:in this windowin a new window TABLE 1. Sequence, PCR-RFLP, and RFLP-SSCP analyses of the Cpgp40/15 gene for genotyping of C. parvum isolates View larger version （85K）:FIG. 1. DNA sequence diversities among C. parvum

29、isolates in the Cpgp40/15 gene. The genes from 16 isolates were sequenced and tentatively grouped into seven types that are indicated on the left as IIa, IIb, IIc, Ia1, Ia2, Ib, and Ie （for the isolate names, see Materials and Methods）. Dots indicate identical base pairs, and hyphens indicate gaps.

30、The differences between IIa and IIb and between Ia1 and Ia2 are indicated by shading. The GenBank accession numbers are AY167589 （CKJ7）, AY167590 （CI2）, AY167591 （GI1）, AY167594 （HJ3）, AY167595 （HN6）, AY167596 （HI2）, and AY167593 （HJ2）. The DNA sequences of isolates from calves from different geographical areas of Japan （code no. CGJ2, CGJ5, CKJ1, CKJ3, CKJ7, and CNJ1） and one from a human patient in Japan （code no. HJ1） were quite similar, with more than 99% identity, and were identified as genotype II （Fig. 1）. Isolates from Italian calves （code no. CI2 and CI8） showed more than 98% DNA seq